View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_low_11 (Length: 280)
Name: NF0445_low_11
Description: NF0445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0445_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 7 - 78
Target Start/End: Original strand, 24875035 - 24875106
Alignment:
Q |
7 |
gaaatagctcaaccaatgcaaagtttctatctccttcccctgtttcacgctctgtttctcagttctctgctc |
78 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24875035 |
gaaatagctcaaccaatgcaaagtttctatctccttcccctgtttcacgctctgtttctcagttctctgctc |
24875106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 25565647 - 25565579
Alignment:
Q |
135 |
aatttaaatttggcaatagattccaaaatgataatattcatcgaataagcaaaattacaatttgatact |
203 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
25565647 |
aatttaaatttggcaataaattccaaaatgataatattcattgaataagcaaaattacaatttgatact |
25565579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 94 - 132
Target Start/End: Complemental strand, 25565712 - 25565674
Alignment:
Q |
94 |
gagcagagacgatattaacatgcatgaagattccacata |
132 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||| |
|
|
T |
25565712 |
gagcagggacgatattaacatgcatgaagattccacata |
25565674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University