View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0445_low_17 (Length: 243)

Name: NF0445_low_17
Description: NF0445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0445_low_17
NF0445_low_17
[»] chr8 (1 HSPs)
chr8 (2-110)||(24743573-24743680)


Alignment Details
Target: chr8 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 2 - 110
Target Start/End: Original strand, 24743573 - 24743680
Alignment:
2 ataatgacaacgcgtctgacacattcagagatcaaaatgactacttttctttttggaaactcagtatccaactcaaactcaacgagacactaatctgagg 101  Q
    |||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| ||||   |||||||||||| ||||||||| | |||||    
24743573 ataatgacaacgcgtctgacacattcagagattaaaatgacta-ttttctttttggaaactcggtattggactcaaactcaatgagacactactttgagg 24743671  T
102 aattaatct 110  Q
    |||||||||    
24743672 aattaatct 24743680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University