View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_low_17 (Length: 243)
Name: NF0445_low_17
Description: NF0445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0445_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 2 - 110
Target Start/End: Original strand, 24743573 - 24743680
Alignment:
| Q |
2 |
ataatgacaacgcgtctgacacattcagagatcaaaatgactacttttctttttggaaactcagtatccaactcaaactcaacgagacactaatctgagg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |||| |||||||||||| ||||||||| | ||||| |
|
|
| T |
24743573 |
ataatgacaacgcgtctgacacattcagagattaaaatgacta-ttttctttttggaaactcggtattggactcaaactcaatgagacactactttgagg |
24743671 |
T |
|
| Q |
102 |
aattaatct |
110 |
Q |
| |
|
||||||||| |
|
|
| T |
24743672 |
aattaatct |
24743680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 52 times since January 2019
Visitors: 3256