View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_low_18 (Length: 236)
Name: NF0445_low_18
Description: NF0445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0445_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 19 - 173
Target Start/End: Complemental strand, 24743680 - 24743527
Alignment:
Q |
19 |
agattaattcctcagattagtgtctcgttgagtttgagttggatactgagtttccaaaaagaaaagtagtcattttgatctctgaatgtgtcagacgcgt |
118 |
Q |
|
|
|||||||||||||| | ||||||||| |||||||||||| |||| |||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
T |
24743680 |
agattaattcctcaaagtagtgtctcattgagtttgagtccaataccgagtttccaaaaagaaaa-tagtcattttaatctctgaatgtgtcagacgcgt |
24743582 |
T |
 |
Q |
119 |
tgtcattatagtaagaaaaacacatttgacaattaaaatgactaactaaagacgc |
173 |
Q |
|
|
||||||||| |||||| ||||||||||||| ||||||||||||||| |||||||| |
|
|
T |
24743581 |
tgtcattatcgtaagagaaacacatttgacgattaaaatgactaaccaaagacgc |
24743527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University