View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0445_low_19 (Length: 213)

Name: NF0445_low_19
Description: NF0445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0445_low_19
NF0445_low_19
[»] chr1 (1 HSPs)
chr1 (1-115)||(52044695-52044815)


Alignment Details
Target: chr1 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 52044815 - 52044695
Alignment:
1 atgtgattgttgagttggtgatagtgttcttgtgtttcaactttttcaatggaactgccaaat-ggatcatttgtttccagaaaacactga-----atct 94  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||     ||||    
52044815 atgtgattgttgagttggtgatagtgttgttgtgtttcaactttttcaatggaactgccaaatgggatcatttgtttccagaaaacactgaatctcatct 52044716  T
95 catgtcttgtgtttgtccatg 115  Q
    |||||||||||||||||||||    
52044715 catgtcttgtgtttgtccatg 52044695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University