View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_low_19 (Length: 213)
Name: NF0445_low_19
Description: NF0445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0445_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 52044815 - 52044695
Alignment:
| Q |
1 |
atgtgattgttgagttggtgatagtgttcttgtgtttcaactttttcaatggaactgccaaat-ggatcatttgtttccagaaaacactga-----atct |
94 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
52044815 |
atgtgattgttgagttggtgatagtgttgttgtgtttcaactttttcaatggaactgccaaatgggatcatttgtttccagaaaacactgaatctcatct |
52044716 |
T |
|
| Q |
95 |
catgtcttgtgtttgtccatg |
115 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
52044715 |
catgtcttgtgtttgtccatg |
52044695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 97 times since January 2019
Visitors: 3257