View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_low_3 (Length: 380)
Name: NF0445_low_3
Description: NF0445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0445_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 3e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 86 - 230
Target Start/End: Complemental strand, 24743499 - 24743354
Alignment:
| Q |
86 |
gggactaaaatggttgtt-acgcttggatgtgggatttactatatagttactctatttgtttggttttgatgcagacattgggaataggacatgcttttt |
184 |
Q |
| |
|
|||||||||||||||||| || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24743499 |
gggactaaaatggttgtttactcttggatttgggatttactatatagttactctatttgtttggttttgatgcagacattgggaataggacatgcttttt |
24743400 |
T |
 |
| Q |
185 |
cttcatttatttggctttgtggccccattacaggccttgtggtagg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24743399 |
cttcatttatttggctttgtggccccattacaggccttgtggtagg |
24743354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 294 - 374
Target Start/End: Complemental strand, 24743290 - 24743210
Alignment:
| Q |
294 |
atacttactattctggcatatatgatttctattgcttcatcagaatatgttcaagccttctatattttatgcctttgtttc |
374 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24743290 |
atacttactattctggcctatatgttttctattgcttcatcagaatatggtcaagccttctatattttatgcctttgtttc |
24743210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University