View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0445_low_3 (Length: 380)

Name: NF0445_low_3
Description: NF0445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0445_low_3
NF0445_low_3
[»] chr8 (2 HSPs)
chr8 (86-230)||(24743354-24743499)
chr8 (294-374)||(24743210-24743290)


Alignment Details
Target: chr8 (Bit Score: 130; Significance: 3e-67; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 86 - 230
Target Start/End: Complemental strand, 24743499 - 24743354
Alignment:
86 gggactaaaatggttgtt-acgcttggatgtgggatttactatatagttactctatttgtttggttttgatgcagacattgggaataggacatgcttttt 184  Q
    |||||||||||||||||| || ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24743499 gggactaaaatggttgtttactcttggatttgggatttactatatagttactctatttgtttggttttgatgcagacattgggaataggacatgcttttt 24743400  T
185 cttcatttatttggctttgtggccccattacaggccttgtggtagg 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
24743399 cttcatttatttggctttgtggccccattacaggccttgtggtagg 24743354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 294 - 374
Target Start/End: Complemental strand, 24743290 - 24743210
Alignment:
294 atacttactattctggcatatatgatttctattgcttcatcagaatatgttcaagccttctatattttatgcctttgtttc 374  Q
    ||||||||||||||||| |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
24743290 atacttactattctggcctatatgttttctattgcttcatcagaatatggtcaagccttctatattttatgcctttgtttc 24743210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1736 times since January 2019
Visitors: 3234