View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_low_4 (Length: 363)
Name: NF0445_low_4
Description: NF0445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0445_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 154 - 267
Target Start/End: Original strand, 17243368 - 17243481
Alignment:
| Q |
154 |
gatgtgggtggagaacaattgtggattgatgttttgaatgctacacttaagcatggactcacacctctctcttggactgattacttgtatttgactgttg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17243368 |
gatgtgggtggagaacaattgtggattgatgttttgaatgctacacttaagcatggactcacacctctctcttggactgattacttgtatttgtctgttg |
17243467 |
T |
 |
| Q |
254 |
gtggcactctctct |
267 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
17243468 |
gtggcactctctct |
17243481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 154 - 233
Target Start/End: Original strand, 52443410 - 52443489
Alignment:
| Q |
154 |
gatgtgggtggagaacaattgtggattgatgttttgaatgctacacttaagcatggactcacacctctctcttggactga |
233 |
Q |
| |
|
||||| || ||||||||| | ||||||||||||||| |||| |||||| | |||||||| ||||| | ||||||||||| |
|
|
| T |
52443410 |
gatgttggaggagaacaactatggattgatgttttgtatgcaacacttgaacatggacttgcacctgtttcttggactga |
52443489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 223 - 263
Target Start/End: Complemental strand, 52630637 - 52630597
Alignment:
| Q |
223 |
tcttggactgattacttgtatttgactgttggtggcactct |
263 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| ||||| |
|
|
| T |
52630637 |
tcttggactgattacttgtatttgtctgtgggtggtactct |
52630597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University