View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0445_low_4 (Length: 363)

Name: NF0445_low_4
Description: NF0445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0445_low_4
NF0445_low_4
[»] chr2 (1 HSPs)
chr2 (154-267)||(17243368-17243481)
[»] chr4 (1 HSPs)
chr4 (154-233)||(52443410-52443489)
[»] chr3 (1 HSPs)
chr3 (223-263)||(52630597-52630637)


Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 154 - 267
Target Start/End: Original strand, 17243368 - 17243481
Alignment:
154 gatgtgggtggagaacaattgtggattgatgttttgaatgctacacttaagcatggactcacacctctctcttggactgattacttgtatttgactgttg 253  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
17243368 gatgtgggtggagaacaattgtggattgatgttttgaatgctacacttaagcatggactcacacctctctcttggactgattacttgtatttgtctgttg 17243467  T
254 gtggcactctctct 267  Q
    ||||||||||||||    
17243468 gtggcactctctct 17243481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 154 - 233
Target Start/End: Original strand, 52443410 - 52443489
Alignment:
154 gatgtgggtggagaacaattgtggattgatgttttgaatgctacacttaagcatggactcacacctctctcttggactga 233  Q
    ||||| || ||||||||| | ||||||||||||||| |||| |||||| | ||||||||  ||||| | |||||||||||    
52443410 gatgttggaggagaacaactatggattgatgttttgtatgcaacacttgaacatggacttgcacctgtttcttggactga 52443489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 223 - 263
Target Start/End: Complemental strand, 52630637 - 52630597
Alignment:
223 tcttggactgattacttgtatttgactgttggtggcactct 263  Q
    |||||||||||||||||||||||| |||| ||||| |||||    
52630637 tcttggactgattacttgtatttgtctgtgggtggtactct 52630597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University