View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0445_low_9 (Length: 307)
Name: NF0445_low_9
Description: NF0445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0445_low_9 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 80 - 307
Target Start/End: Complemental strand, 52288821 - 52288592
Alignment:
Q |
80 |
attcacaaaccaaatttgcttgcatgggaatttgtaaataagacatatgtaagattccaaaatggctcttaaatttatagacaaacttttaacaaaatgc |
179 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52288821 |
attcacaaaccaaatttgcttgcatgggaatttgtaaataagacatatataagattccaaaatggctcttaaatttatagacaaacttttaacaaaatgc |
52288722 |
T |
 |
Q |
180 |
accataagtcgtgggtc--tattatgctcgacaaatactctatttactgcccacagattcctgtcttctttccaatctcttctgctaacatagataattg |
277 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
52288721 |
accataagtcgtgggtcaatattatgctcgacaaatactctatttactgcccacagattcctgtcttctttccaatctcttctgctaaaatagataattg |
52288622 |
T |
 |
Q |
278 |
tagttcactgttaaatgaattttgttttaa |
307 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
52288621 |
tagttcactgttaaatgaattttgttttaa |
52288592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University