View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0446_high_10 (Length: 233)
Name: NF0446_high_10
Description: NF0446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0446_high_10 |
 |  |
|
| [»] chr6 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 1891067 - 1891299
Alignment:
| Q |
1 |
gtcaaactataagcgatttcaaacacgcacttagtatttatacagactaatttcttcttgttttttcttatgatgtctgtttgcagattggttccaccac |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1891067 |
gtcaaactatatgcgatttcaaacacgcacttagtatttatacagactaatttcttcttgttttttcttatgatgtctgtttgcagattgcttccaccac |
1891166 |
T |
 |
| Q |
101 |
taagtttctccacaatattgaaaagtgtgcttcttggagcaatagggtaatgccaaaatggtcttatcctttactccaattattgttaatgtgtctttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1891167 |
taagtttctccacaatattgaaaagtgtgcttcttggagcaatagggtaatgccaaaatgatcttatcctttactccaattattgttaatgtgtctttta |
1891266 |
T |
 |
| Q |
201 |
gtatactactgcctcgttctttattataggaga |
233 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
1891267 |
gtatactactacctcgttctttattataggaga |
1891299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 97 - 180
Target Start/End: Original strand, 1895942 - 1896026
Alignment:
| Q |
97 |
ccactaagtttctccacaatattgaaaagtgtgcttcttggagcaatagggtaatgcc-aaaatggtcttatcctttactccaat |
180 |
Q |
| |
|
||||| |||||||||| | ||| |||| ||| |||||||| |||||||||||||||| ||||||| ||||| ||||||| |||| |
|
|
| T |
1895942 |
ccactcagtttctccatagtatgcaaaattgtacttcttggtgcaatagggtaatgccaaaaatggccttatactttactacaat |
1896026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 103 - 158
Target Start/End: Original strand, 1905803 - 1905858
Alignment:
| Q |
103 |
agtttctccacaatattgaaaagtgtgcttcttggagcaatagggtaatgccaaaa |
158 |
Q |
| |
|
|||||||| | ||||| ||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
1905803 |
agtttctctataatatgtaaaagtgtgcttcttggtgcaatagggtaatggcaaaa |
1905858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 151
Target Start/End: Original strand, 1884378 - 1884432
Alignment:
| Q |
97 |
ccactaagtttctccacaatattgaaaagtgtgcttcttggagcaatagggtaat |
151 |
Q |
| |
|
||||| |||||||||| ||||| |||| ||||||||||||||| |||||||||| |
|
|
| T |
1884378 |
ccactcagtttctccataatatgcaaaattgtgcttcttggagcgatagggtaat |
1884432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University