View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0446_high_11 (Length: 227)
Name: NF0446_high_11
Description: NF0446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0446_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 44 - 207
Target Start/End: Original strand, 1861153 - 1861320
Alignment:
| Q |
44 |
tagtctaaatgaatcgaaattgaactgattttattaatttatttttcaatcgattaaactatgctcaaaaggtttcactaatttgac----gtatgggtt |
139 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1861153 |
tagtctaaatgaatcggaattgaactgattttattaatttattttctaatggattaaactatgctcaaaaggtttcactaatttgaccttcgtatgggtt |
1861252 |
T |
 |
| Q |
140 |
taaaattttgtaccacaaatgtcttatcgaaaccacataatatataactacaaaaacaatagtaacat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1861253 |
taaaattttgtaccacaaatgtcttatcgaaaccacataatatataactacaaaaacaatagtgacat |
1861320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University