View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0446_high_12 (Length: 227)
Name: NF0446_high_12
Description: NF0446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0446_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 5 - 148
Target Start/End: Complemental strand, 1861024 - 1860875
Alignment:
| Q |
5 |
caatcaataacttgatcaattttttccttaaaaagaataacttgatcaatttttgattcaatttattgaattaatcttcagtcgtctgattttcaaaata |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||| | |
|
|
| T |
1861024 |
caatcaataacttgatcaattttttccttaaaaaaaataacttgatcaatttttggttcaatttattgaattaatcttcgatcatctgattttcaaaaga |
1860925 |
T |
|
| Q |
105 |
tttgtggt-gatgaacaaca-----tagtagtcaactacactgtaaaaaa |
148 |
Q |
| |
|
|||||||| | |||| |||| ||||||| ||||||||||||||||| |
|
|
| T |
1860924 |
tttgtggtggctgaataacaacaagtagtagtgaactacactgtaaaaaa |
1860875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 162 - 207
Target Start/End: Complemental strand, 1860806 - 1860761
Alignment:
| Q |
162 |
acctaaaatcgtttttaagcattaattgattttgggtgtctatcat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1860806 |
acctaaaatcgtttttaagcattaattgattttgggtgtctatcat |
1860761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University