View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0446_low_11 (Length: 251)
Name: NF0446_low_11
Description: NF0446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0446_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 31639471 - 31639712
Alignment:
| Q |
1 |
cggttcaatctctggtccgatttttaggacattgatctcatcacgtgttgaaatgagtgtgtcgttagcatttcttagtaaacaaaacaaggagtctgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31639471 |
cggttcaatctctggtccgatttttaggacattgatctcatcacatgttgaaatgagtgtgtcgttagcatttcttagtaaacaaaacaaggagtctgta |
31639570 |
T |
|
| Q |
101 |
aagaagctgaaaatatcaataatatttgtgttatttgatggataatccaggaacaacaaggaggtaaaatagggatagcactagatgctgtttggtatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31639571 |
aagaagctgaaaatatcaataatatttgtgtcatttgatggataatccaggaaaaacaaggaggtaaaatagggatagcactagatgctgtttggtatga |
31639670 |
T |
|
| Q |
201 |
acctataactgaacttgatgaagacaaagaagcaacagctag |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31639671 |
acctataactgaacttgatgaagacaaagaagcagcagctag |
31639712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University