View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0446_low_12 (Length: 245)
Name: NF0446_low_12
Description: NF0446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0446_low_12 |
 |  |
|
[»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 95 - 245
Target Start/End: Original strand, 25960304 - 25960454
Alignment:
Q |
95 |
tccttgagaatatagacagtaagcaccactgatcaaaatttattattcaagtaatttcaacaatagttttaattaaaattaagcttgcttcaacgggcat |
194 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25960304 |
tccttgagaatatagacagtaagcaccactgatcaaaatttattattcaagtaatttcaacaatagttttaattaaaattaagcttgcttcaacgggcat |
25960403 |
T |
 |
Q |
195 |
aataccaaaaagagtgatgaagcaccgacactttgagattgaagagcaaca |
245 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||| | |||||| |
|
|
T |
25960404 |
aataccaaaaagagtgatgcagcaccgacactttgagattgaggggcaaca |
25960454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 95 - 227
Target Start/End: Original strand, 25951054 - 25951186
Alignment:
Q |
95 |
tccttgagaatatagacagtaagcaccactgatcaaaatttattattcaagtaatttcaacaatagttttaattaaaattaagcttgcttcaacgggcat |
194 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||||| |||||||||| |||| |
|
|
T |
25951054 |
tccttgagaatatagagagtaagcaccactgatcaaaacttattattcaagtaatttcaaaaatagttttaattgaaattaagcgtgcttcaacgagcat |
25951153 |
T |
 |
Q |
195 |
aataccaaaaagagtgatgaagcaccgacactt |
227 |
Q |
|
|
||||||||||| ||||||| ||||| ||||||| |
|
|
T |
25951154 |
aataccaaaaacagtgatgcagcactgacactt |
25951186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University