View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0446_low_18 (Length: 207)
Name: NF0446_low_18
Description: NF0446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0446_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 10299388 - 10299293
Alignment:
| Q |
1 |
acatgaatggaaatatttacatgatttcatttggtattgtggagatctttttctctcaaattcctgactttgatcagttatggtggctctctgctc |
96 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10299388 |
acatgaatggaaacatttacatgatttcatttggtattgtggagatctttttctctcaaattcctgactttgatcagttatggtggctctctgctc |
10299293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 12 - 91
Target Start/End: Original strand, 40200696 - 40200775
Alignment:
| Q |
12 |
aatatttacatgatttcatttggtattgtggagatctttttctctcaaattcctgactttgatcagttatggtggctctc |
91 |
Q |
| |
|
|||||||||||||||||||||||| || | || | |||||||||||||| || |||||||| |||||||||||||| |
|
|
| T |
40200696 |
aatatttacatgatttcatttggtgcagtacaaattatattctctcaaattccagattttgatcaattatggtggctctc |
40200775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University