View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0446_low_20 (Length: 203)

Name: NF0446_low_20
Description: NF0446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0446_low_20
NF0446_low_20
[»] chr6 (2 HSPs)
chr6 (53-111)||(2698441-2698499)
chr6 (5-55)||(2698540-2698590)


Alignment Details
Target: chr6 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 53 - 111
Target Start/End: Complemental strand, 2698499 - 2698441
Alignment:
53 cttatgtgtgagtgtttttgtcatagtaaatggtgggtacgtgtgcaattgcttctgtg 111  Q
    |||||||||| ||||||| ||||||||||||||||||||||||||||| ||||||||||    
2698499 cttatgtgtgggtgttttcgtcatagtaaatggtgggtacgtgtgcaactgcttctgtg 2698441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 5 - 55
Target Start/End: Complemental strand, 2698590 - 2698540
Alignment:
5 gacagtttgaggttgtgctttggattgtaatgcttgaaagggcggtgtctt 55  Q
    |||||||||||||| ||||||||| |||||||||||||||| |||||||||    
2698590 gacagtttgaggttttgctttggactgtaatgcttgaaaggacggtgtctt 2698540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University