View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0446_low_7 (Length: 315)
Name: NF0446_low_7
Description: NF0446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0446_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 23 - 242
Target Start/End: Original strand, 49031685 - 49031904
Alignment:
| Q |
23 |
tagttgggaggaaagggagcaaacttggccgaaatggcaacaattggattatctgtgcctcctggactcactatatcaacagaagcatgtcaagaatatc |
122 |
Q |
| |
|
|||||||||||||||||||| ||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49031685 |
tagttgggaggaaagggagcgaacttagcagaaatggcaacaattggattatctgtccctcctggactcactatatcaacagaagcatgtcaagaatatc |
49031784 |
T |
 |
| Q |
123 |
aagaaaatgtaaagaacctaccaaatggtttgtgggaggagatacttgaaggccttaattttgtgcaaaatgaaatgggggcctttcttgggaatccttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49031785 |
aagaaaatgtaaagaacctaccaaatggtttgtgggaggagatacttgaaggccttaattttgtgcaaaatgaaatgggggcctttcttgggaatccttc |
49031884 |
T |
 |
| Q |
223 |
aaaacctctcctcgtctctg |
242 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
49031885 |
aaaacctctcctcgtctctg |
49031904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University