View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0446_low_9 (Length: 266)
Name: NF0446_low_9
Description: NF0446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0446_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 12 - 189
Target Start/End: Complemental strand, 17664601 - 17664424
Alignment:
| Q |
12 |
acagacaaacagataaaatagttagcaatcaattatttaaacagataaaaatgcaagccggctttaggaaaaattaacaaaaagctaacttaacttaacc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17664601 |
acagacaaacagataaaatagttagcaatcaattatttaaacagataaaaatgcaagccggctttaggaaaaattaacaaaaagctaacttaacttaacc |
17664502 |
T |
 |
| Q |
112 |
aatagtccaagtaatctaggtaactttggcaaagtattattgattttcctcagttcctctctaactgtttgcagccat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17664501 |
aatagtccaagtaatctaggtaactttggcaaagtattattgattttcctcagttcctctctatctgtttgcagccat |
17664424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 15 - 50
Target Start/End: Original strand, 17699622 - 17699657
Alignment:
| Q |
15 |
gacaaacagataaaatagttagcaatcaattattta |
50 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17699622 |
gacaaacagataaaattgttagcaatcaattattta |
17699657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University