View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0447-Insertion-10 (Length: 175)
Name: NF0447-Insertion-10
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0447-Insertion-10 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 6e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 8 - 175
Target Start/End: Complemental strand, 50788239 - 50788072
Alignment:
| Q |
8 |
tctctttccttgtcaaaaagcataagagtagaatattatggaaaaaacacttcacctttttctgattttacctaggaaacagtgcttcatttttgagccc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50788239 |
tctctttccttgtcaaaaagcataagagtagaatattatggaaaaaacacttcacctttttctgattttacctaggaaacagtgcttcatttttcagccc |
50788140 |
T |
|
| Q |
108 |
atttctttttcatcctattcacgtgttgctatgttatgaacttgtgtggtgttgttacgatctttgtt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50788139 |
atttctttttcatcctattcacgtgttgctatgttatgaacttgtgtggtgttgttacgatctttgtt |
50788072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University