View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0447-Insertion-21 (Length: 73)
Name: NF0447-Insertion-21
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0447-Insertion-21 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 67; Significance: 2e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 2e-30
Query Start/End: Original strand, 7 - 73
Target Start/End: Complemental strand, 41610665 - 41610599
Alignment:
| Q |
7 |
agttggaacgttaaaatcagtttcagaaacttttgttgttgtctataataatgcttggtttgttagc |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41610665 |
agttggaacgttaaaatcagtttcagaaacttttgttgttgtctataataatgcttggtttgttagc |
41610599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University