View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0447-Insertion-26 (Length: 105)
Name: NF0447-Insertion-26
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0447-Insertion-26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 2e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 7 - 95
Target Start/End: Original strand, 31152514 - 31152602
Alignment:
Q |
7 |
acattgattataaacttgcgtatatgatagttgaagttgaaaaatgaaattaaaattttattttatccttgtaagttatagttggcttg |
95 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31152514 |
acattgattataaacttgcgtatatgatagttgaagttgaaaaatgaaattaaaattttattttatccttgtaagttatagttggcttg |
31152602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 7 - 95
Target Start/End: Original strand, 31171076 - 31171164
Alignment:
Q |
7 |
acattgattataaacttgcgtatatgatagttgaagttgaaaaatgaaattaaaattttattttatccttgtaagttatagttggcttg |
95 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31171076 |
acattgattataaacttgcgtatatgatagttgaagttgaaaaatgaaattaaaattttattttatccttgtaagttatagttggcttg |
31171164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University