View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| ||||||||||||||||
Alignment Overview
Query: NF0447-Insertion-27 (Length: 155)
Name: NF0447-Insertion-27
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| |||||
| |||||
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 1e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 8 - 155
Target Start/End: Original strand, 9057836 - 9057992
Alignment:
| Q | 8 | gttagaccttcagattatgaagatggatatgctaaagttgatattcttaatgaacaaaacaatgaaaattttaatgcagttaaagtatca---------c | 98 | Q |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | | ||||
| T | 9057836 | gttagaccttcagattatgaagatggatatgctaaagttgatattcttaatgaacaaaacaatgaagattttaatgcagttaaagtatcacttggtgtgc | 9057935 | T |
 | ||||
| Q | 99 | ttggtgttatttcacgggtatggtctttgatttttgtctttctttctagttttggta | 155 | Q |
| ||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| | ||||
| T | 9057936 | ttggtgttatttcacaggtacggtctttgatttttgtctttctttctagttttggta | 9057992 | T |
| ||||
Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 7e-32
Query Start/End: Original strand, 8 - 105
Target Start/End: Original strand, 9063960 - 9064057
Alignment:
| Q | 8 | gttagaccttcagattatgaagatggatatgctaaagttgatattcttaatgaacaaaacaatgaaaattttaatgcagttaaagtatcacttggtgt | 105 | Q |
| ||||| ||||| |||| ||| |||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |||||||||||||||||| | ||||
| T | 9063960 | gttaggccttcggattctgacgatggatatgctaaagttgagattcttaatgaacaaaacaatgaagattttaatgcagctaaagtatcacttggtgt | 9064057 | T |
| ||||
Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University