View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0447-Insertion-7 (Length: 312)
Name: NF0447-Insertion-7
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0447-Insertion-7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 6 - 247
Target Start/End: Original strand, 38931352 - 38931593
Alignment:
| Q |
6 |
cattgggcactaagatgaagcaatttgagaactgggagagtcaaactattgacattcgttatacgacctgctcttgggttaaacacatcggcacgtgaag |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931352 |
cattgggcactaagatgaagcaatttgagaactgggagagtcaaactattgacattcgttatacgacctgctcttgggttaaacacatcggcacgtgaag |
38931451 |
T |
|
| Q |
106 |
gatcagctatgttctcatgaagcttcaatgtgcaaacggtttcatcgaagaagttgtgttgttcttcatgttctctggttcttgttctctcaccatggct |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931452 |
gatcagctatgttctcatgaagcttcaatgtgcaaacagtttcatcgaagaagttgtgttgtccttcatgttctctggttcttgttctctcaccatggct |
38931551 |
T |
|
| Q |
206 |
tctttctttttcaccatggtgacaatgctctttagtttttgt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38931552 |
tctttctttttcaccatggtgacaatgctctttagtttttgt |
38931593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University