View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0447_high_22 (Length: 258)

Name: NF0447_high_22
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0447_high_22
NF0447_high_22
[»] chr1 (1 HSPs)
chr1 (37-232)||(34071437-34071633)


Alignment Details
Target: chr1 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 37 - 232
Target Start/End: Original strand, 34071437 - 34071633
Alignment:
37 acgagggagtggcttgaggtttactttggttcaacgaattaacttctataacaaatgccatacatgagtttgattccaaaatggttgtgaattgtttcaa 136  Q
    ||||||||| |||||||||||||||||||||| |||||||||||  |||||||| ||||||| ||||||||||||| || ||||||||||||||||||||    
34071437 acgagggagcggcttgaggtttactttggttcgacgaattaactcttataacaa-tgccatatatgagtttgattctaagatggttgtgaattgtttcaa 34071535  T
137 tcatctatgtacgaatatgtccaaatttggctttatattacaatatt--taatttggcttaaagtcatgtttagtccaaacaaattggttagcaaaca 232  Q
    || |||||||||| |||| || ||||||  |||||||||||||||||  |||||||||||||||||||||||||||||||| |||||||| |||||||    
34071536 tcttctatgtacggatatctcaaaatttaactttatattacaatatttataatttggcttaaagtcatgtttagtccaaacgaattggttggcaaaca 34071633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University