View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0447_high_27 (Length: 251)
Name: NF0447_high_27
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0447_high_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 32 - 68
Target Start/End: Complemental strand, 42018098 - 42018062
Alignment:
| Q |
32 |
caacactttgttcattgtatcatcggaagtttgagag |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42018098 |
caacactttgttcattgtatcatcggaagtttgagag |
42018062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University