View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0447_low_20 (Length: 286)
Name: NF0447_low_20
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0447_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 7 - 92
Target Start/End: Original strand, 28718823 - 28718908
Alignment:
| Q |
7 |
ctcccattgttgcaaccaaaacacccttaggttacaacataatgccctcgaatggaaaggaatctcattcaaaattaattgaagct |
92 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||| |||| | |||||||||||| | |||||||||||||||||| |
|
|
| T |
28718823 |
ctcccgttgtttcaaccaaaacacccttaggttacaacataatatcctcagaaggaaaggaatctgactcaaaattaattgaagct |
28718908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 190 - 238
Target Start/End: Complemental strand, 28718897 - 28718849
Alignment:
| Q |
190 |
attttgagcaagattccttgccttttgaggatattatgttgtaacctaa |
238 |
Q |
| |
|
|||||||| ||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
28718897 |
attttgagtcagattcctttccttctgaggatattatgttgtaacctaa |
28718849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University