View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0447_low_28 (Length: 265)
Name: NF0447_low_28
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0447_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 56471984 - 56471816
Alignment:
| Q |
1 |
aggaggaagatagaataataatatcatcaagatcttcatctggtggtgggttgacgttgagagagcctctccttgtgaagaataacaacaggctcaatac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56471984 |
aggaggaagatagaataataatatcatcaagatcttcatctggcgg---gttgacgttgagagagcctctccttgtgaagaataacaacaggctcaatac |
56471888 |
T |
 |
| Q |
101 |
tacctcccaggttgccattgttggagccaatgtttgtcaaattgaaagtcttgactacgagtatgtattgat |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56471887 |
tacctcccaggttgccattgttggagccaatgtttgtcaaattgaaagtcttgactacgagtatgtattgat |
56471816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University