View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0447_low_32 (Length: 253)
Name: NF0447_low_32
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0447_low_32 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 32 - 253
Target Start/End: Original strand, 17661407 - 17661624
Alignment:
| Q |
32 |
ctccccatccttatttggataacgctctacttgcagatacatcctcaattgaactcatcccccgatttcattaaaatgtcgagcaagtgttgcattcatt |
131 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17661407 |
ctccccatccttattttgataacgc----cttgcagatacatccttaattgaactcatcccccggtttcattaaaatgtcgagcaagtgttgcattcatt |
17661502 |
T |
 |
| Q |
132 |
tcattttcagcgataaatttgcaactaattcaatgataacaatgcgttnnnnnnncaaggctccatggtcaaccaaggctcctctctcacctcaaaacct |
231 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17661503 |
tcattttcaacgttaaatttgcaactaattcaatgataacaatgcgttaaaaaaacaagcctccatggtcaaccaaggctcctctctcacctcaaaacct |
17661602 |
T |
 |
| Q |
232 |
cgagaaatgcattgttatttat |
253 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
17661603 |
tgggaaatgcattgttatttat |
17661624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University