View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0447_low_37 (Length: 242)
Name: NF0447_low_37
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0447_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 35093391 - 35093167
Alignment:
| Q |
1 |
gcacagatgcaggtaaagaggattgaaggcccactagaaaatcaggcaccgtatggcgatgcagatctccttataactatatagacnnnnnnnctacatc |
100 |
Q |
| |
|
||||||||||| ||||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35093391 |
gcacagatgcatataaagaggactgaagccccactagaaaatcaggcaccgtaaggcgatgcagatctccttataactatatagacaacacaactacatc |
35093292 |
T |
 |
| Q |
101 |
tgatgactttaatattaaacctgattaattacctttcctatagcgggcatgcatcaaaaagtataatttgaataatttatattgtatatatagtactttt |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |||| |
|
|
| T |
35093291 |
tgctgactttaatattaaacctgattaattacctttcctagagcgggcatgcatcaaaaagtataatttgactaatttatattgtatatat-gtaatttt |
35093193 |
T |
 |
| Q |
201 |
caatcaactccaaaattctacacaat |
226 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
35093192 |
caatcaactccaaaattctatacaat |
35093167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University