View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0447_low_39 (Length: 239)
Name: NF0447_low_39
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0447_low_39 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 38 - 229
Target Start/End: Original strand, 8454705 - 8454896
Alignment:
| Q |
38 |
tatttgatgggatggttgacactgataagaattttgttacttggaatgttacgattaatgggtatatgaaatcggggaaaattgaattggtgagtggatt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8454705 |
tatttgatgggatggttgacactgataagaattttgttacttggaatgttacgattaatgggtatatgaaatcggggaaaattgaattggcgagtggatt |
8454804 |
T |
|
| Q |
138 |
gtttgagcggatgcctgctaggagtttgataagctgaaattcgatgatagatggatatcagcacaatgtgtatttttctggatccttctctg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8454805 |
gtttgagcggatgcctgctaggagtttgataagctgaaattcgatgatagatggatatcagcacaatgtgtatttttctggatccttctctg |
8454896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 60 - 197
Target Start/End: Complemental strand, 42605388 - 42605251
Alignment:
| Q |
60 |
tgataagaattttgttacttggaatgttacgattaatgggtatatgaaatcggggaaaattgaattggtgagtggattgtttgagcggatgcctgctagg |
159 |
Q |
| |
|
|||||||| ||| ||||| |||||||| | |||| ||||||||||||| ||||||||||||||||||| | || |||||||||| |||||| ||| |
|
|
| T |
42605388 |
tgataagagtttggttacgtggaatgtaatgattcatgggtatatgaagtcggggaaaattgaattggcggctgaattgtttgagacgatgccaaagagg |
42605289 |
T |
|
| Q |
160 |
agtttgataagctgaaattcgatgatagatggatatca |
197 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42605288 |
agtttgataagctggaattcgatgatagatggatatca |
42605251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University