View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0447_low_4 (Length: 418)
Name: NF0447_low_4
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0447_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 160 - 407
Target Start/End: Original strand, 46472420 - 46472664
Alignment:
| Q |
160 |
ttacacgagtacgatttcgatttattgaccatgtgggaactaggattcaaatattacttgatatcagtttgatgaactcggcaactttggccttggactg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46472420 |
ttacacgagtacgatttcgatttattgaccatgtgggaactaggattcaaatattacttgatatcagtttgatgaactcaacaactttggccttggactg |
46472519 |
T |
 |
| Q |
260 |
tttaaatattactatgtaagaagtctcagacattttcaaatccataaagacattcaccttgcagtatggaaccaaatactatgcaacctttgtcttaaac |
359 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46472520 |
tttaaatattactttgtaag---tctcagacattttcaaattcctaaagacattcaccttgcagtatggaaccaaatactatgcaacctttgtcttaaac |
46472616 |
T |
 |
| Q |
360 |
tttgctatttttcacttcacaaatctccgtatctttcaccttgtctct |
407 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
46472617 |
tttgctatttttcacttcacaaatctccatagctttcaccttgtctct |
46472664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 48 - 114
Target Start/End: Original strand, 46472315 - 46472381
Alignment:
| Q |
48 |
caaactagcatattataattgtttttaggaatataattgtcattattttatgaaccataggaatata |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46472315 |
caaactagcatattataattgtttttaggaatataattgtcattattttctgaaccataggaatata |
46472381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 73 - 114
Target Start/End: Original strand, 46472372 - 46472413
Alignment:
| Q |
73 |
taggaatataattgtcattattttatgaaccataggaatata |
114 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46472372 |
taggaatataattgtcattattttaagaaccataggaatata |
46472413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University