View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0447_low_40 (Length: 231)
Name: NF0447_low_40
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0447_low_40 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 31694272 - 31694372
Alignment:
| Q |
1 |
ttctctctacagtttcatcccatctcccattccgcctccgtccaatccaccggcggcagcctcttagccgcctaccacctccaagtccg-cctctgcacc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
31694272 |
ttctctctacagtttcatcccatctcccatttcgcctccgtccaatccaccggcggcagcctcttagccgcctaccacctccaagtccgccctctgcacc |
31694371 |
T |
|
| Q |
100 |
g |
100 |
Q |
| |
|
| |
|
|
| T |
31694372 |
g |
31694372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University