View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0447_low_41 (Length: 226)
Name: NF0447_low_41
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0447_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 5 - 126
Target Start/End: Complemental strand, 17662419 - 17662298
Alignment:
Q |
5 |
gtttataaattaatagttagggcttttccgaagaaatagctagggtttatcttactttctctttctttcatcaaacttcaactttcttacctttagttta |
104 |
Q |
|
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
17662419 |
gtttataaagtaatagttaggacttttccgaagaaatagctagggtttatcttactttctctttctttcatcaaacttcaactttgttacctttagttta |
17662320 |
T |
 |
Q |
105 |
ttttcatcactcccttattctc |
126 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
17662319 |
ttttcatcactcccttattctc |
17662298 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 5 - 126
Target Start/End: Original strand, 17701664 - 17701784
Alignment:
Q |
5 |
gtttataaattaatagttagggcttttccgaagaaatagctagggtttatcttactttctctttctttcatcaaacttcaactttcttacctttagttta |
104 |
Q |
|
|
||||||||| ||||| ||||| ||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| | ||| || ||||| |
|
|
T |
17701664 |
gtttataaagcaatagctaggg-ttttccgaagaaatagctagggtttatcttaatttatctttctttcatcaaacttcaactttgtcaccgttggttta |
17701762 |
T |
 |
Q |
105 |
ttttcatcactcccttattctc |
126 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
17701763 |
ttttcatcactcccttattctc |
17701784 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University