View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0447_low_41 (Length: 226)

Name: NF0447_low_41
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0447_low_41
NF0447_low_41
[»] chr1 (2 HSPs)
chr1 (5-126)||(17662298-17662419)
chr1 (5-126)||(17701664-17701784)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 5 - 126
Target Start/End: Complemental strand, 17662419 - 17662298
Alignment:
5 gtttataaattaatagttagggcttttccgaagaaatagctagggtttatcttactttctctttctttcatcaaacttcaactttcttacctttagttta 104  Q
    ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
17662419 gtttataaagtaatagttaggacttttccgaagaaatagctagggtttatcttactttctctttctttcatcaaacttcaactttgttacctttagttta 17662320  T
105 ttttcatcactcccttattctc 126  Q
    ||||||||||||||||||||||    
17662319 ttttcatcactcccttattctc 17662298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 5 - 126
Target Start/End: Original strand, 17701664 - 17701784
Alignment:
5 gtttataaattaatagttagggcttttccgaagaaatagctagggtttatcttactttctctttctttcatcaaacttcaactttcttacctttagttta 104  Q
    |||||||||  ||||| ||||| ||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| | ||| || |||||    
17701664 gtttataaagcaatagctaggg-ttttccgaagaaatagctagggtttatcttaatttatctttctttcatcaaacttcaactttgtcaccgttggttta 17701762  T
105 ttttcatcactcccttattctc 126  Q
    ||||||||||||||||||||||    
17701763 ttttcatcactcccttattctc 17701784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University