View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0447_low_42 (Length: 223)
Name: NF0447_low_42
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0447_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 10299368 - 10299293
Alignment:
| Q |
1 |
atgatttcatttggtattgtggagatctttttctctcaaattcctgactttgatcagttatggtggctctctgctc |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10299368 |
atgatttcatttggtattgtggagatctttttctctcaaattcctgactttgatcagttatggtggctctctgctc |
10299293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 217
Target Start/End: Complemental strand, 1767480 - 1767423
Alignment:
| Q |
160 |
cttacacgaattccacaacctgcaaaatgactattatcatgcaccaaagttcttaacc |
217 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| |||||||||| ||||||| |||||| |
|
|
| T |
1767480 |
cttacacgaaatccacaacatgcaaaatgacacttatcatgcaacaaagttgttaacc |
1767423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 71
Target Start/End: Original strand, 40200735 - 40200775
Alignment:
| Q |
31 |
ttctctcaaattcctgactttgatcagttatggtggctctc |
71 |
Q |
| |
|
|||||||||||||| || |||||||| |||||||||||||| |
|
|
| T |
40200735 |
ttctctcaaattccagattttgatcaattatggtggctctc |
40200775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University