View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0447_low_42 (Length: 223)

Name: NF0447_low_42
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0447_low_42
NF0447_low_42
[»] chr1 (2 HSPs)
chr1 (1-76)||(10299293-10299368)
chr1 (160-217)||(1767423-1767480)
[»] chr3 (1 HSPs)
chr3 (31-71)||(40200735-40200775)


Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 10299368 - 10299293
Alignment:
1 atgatttcatttggtattgtggagatctttttctctcaaattcctgactttgatcagttatggtggctctctgctc 76  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10299368 atgatttcatttggtattgtggagatctttttctctcaaattcctgactttgatcagttatggtggctctctgctc 10299293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 217
Target Start/End: Complemental strand, 1767480 - 1767423
Alignment:
160 cttacacgaattccacaacctgcaaaatgactattatcatgcaccaaagttcttaacc 217  Q
    |||||||||| |||||||| |||||||||||  |||||||||| ||||||| ||||||    
1767480 cttacacgaaatccacaacatgcaaaatgacacttatcatgcaacaaagttgttaacc 1767423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 71
Target Start/End: Original strand, 40200735 - 40200775
Alignment:
31 ttctctcaaattcctgactttgatcagttatggtggctctc 71  Q
    |||||||||||||| || |||||||| ||||||||||||||    
40200735 ttctctcaaattccagattttgatcaattatggtggctctc 40200775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University