View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0447_low_46 (Length: 208)
Name: NF0447_low_46
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0447_low_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 52887822 - 52887937
Alignment:
| Q |
1 |
ttataactcttcttataattaacactcttatgcttcaatactcttcaattcattggccaccctcctttcttcactgtactttcctttctcctcgggcaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52887822 |
ttataactcttcttataattaacactcttatccttc----------aattcattggccaccctcctttcttcactgtactttcctttctcctcgggcaac |
52887911 |
T |
|
| Q |
101 |
tccaatttcctttctttactctctgc |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
52887912 |
tccaatttcctttctttactctctgc |
52887937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University