View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0447_low_49 (Length: 208)
Name: NF0447_low_49
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0447_low_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 8e-57; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 37155721 - 37155832
Alignment:
| Q |
1 |
agtttcgacggctagatggttatcagggattgaatcgtcggcaagagaacgagaaacagtccggagtttaagatgatctgaggtcggaacaccttcagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37155721 |
agtttcgacggctagatggttatcagggattgaatcgtcggcaagagaacgagaaacagtccggagtttaagatgatctgaggtcggaacaccttcagga |
37155820 |
T |
 |
| Q |
101 |
caatattcagct |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37155821 |
caatattcagct |
37155832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 37161322 - 37161419
Alignment:
| Q |
1 |
agtttcgacggctagatggttatcagggattgaatcgtcggcaagagaacgagaaacagtccggagtttaagatgatctgaggtcggaacaccttcag |
98 |
Q |
| |
|
|||||| || |||||||| ||||||||||||||||| |||||||||||| |||| ||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37161322 |
agtttcaactgctagatgattatcagggattgaatcatcggcaagagaaagagacacagtacggagtttaagatgatctgaggttggaacaccttcag |
37161419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 37150595 - 37150694
Alignment:
| Q |
1 |
agtttcgacggctagatggttatcagggattgaatcgtcggcaagagaacgagaaacagtccggagtttaagatgatctgaggtcggaacaccttcagga |
100 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| || | |||||||||| |||||||||| ||||||||||||||||| || || |||||||| |||||| |
|
|
| T |
37150595 |
agtttcgacgattagatggtcatcagggattgattcatgggcaagagaaagagaaacagtgcggagtttaagatgatccgacgttggaacaccctcagga |
37150694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University