View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0447_low_54 (Length: 202)

Name: NF0447_low_54
Description: NF0447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0447_low_54
NF0447_low_54
[»] chr7 (1 HSPs)
chr7 (1-121)||(40484377-40484497)


Alignment Details
Target: chr7 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 40484377 - 40484497
Alignment:
1 ccataccactcttaaaggatcttctgtgatgtcttctttatcatttttggtttgcgnnnnnnntctcaaagatatgtgtctacattgacacttgaatgta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||    
40484377 ccataccactcttaaaggatcttctgtgatgtcttctttatcatttttggtttgcgaaaaaaatctcaaagatatgtgtctacattgacacttgaatgta 40484476  T
101 tcatgctcttcattctgtgct 121  Q
    |||||||||||||||||||||    
40484477 tcatgctcttcattctgtgct 40484497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University