View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0448_high_12 (Length: 270)
Name: NF0448_high_12
Description: NF0448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0448_high_12 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 50 - 270
Target Start/End: Complemental strand, 2441161 - 2440941
Alignment:
| Q |
50 |
ccccggatcccctcacgacacagcattctcaccactatttcactgtcaaagcattacctctattaatgataactaacacgtctcattaactaattaaaag |
149 |
Q |
| |
|
||||| |||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2441161 |
ccccgaatcccctcacgagatagcattctcaccactatttcactgtcaaagcattacctctattaatgataactaacacgtctcattaactaattaaaag |
2441062 |
T |
|
| Q |
150 |
aatctatcagttgaaccatactgataatataaacatttattacaagaaactatatcagttcaatgtttgttgtgaactaacaccacatttgagttcaagt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2441061 |
aatctatcagttgaaccatactgataatataaacatttattacaagaaactatatcagttcaatgtttgttgtgaactaacaccacatttgagttcaagt |
2440962 |
T |
|
| Q |
250 |
cacaatggcttcctttctatc |
270 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
2440961 |
cacaatggattcctttctatc |
2440941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 32 times since January 2019
Visitors: 3252