View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0448_high_16 (Length: 234)
Name: NF0448_high_16
Description: NF0448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0448_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 5288547 - 5288404
Alignment:
Q |
1 |
cactcgtcgatcgcaaccaccattaccaatttaccattaattaactgtgttatgctatatttttaggtttgattttgttgctcccagtaccttctttcaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5288547 |
cactcgtcgatcgcaaccaccattaccaatttacgattaattaactgtgttatgctatatttttaggtttgattttgttgctcccagtaccttctttcaa |
5288448 |
T |
 |
Q |
101 |
ggttagttactgatctctgttttactacttgtaatgttgatgat |
144 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
5288447 |
ggttagttactgatctctgttttactacttgtaatgttgttgat |
5288404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 8034866 - 8035009
Alignment:
Q |
1 |
cactcgtcgatcgcaaccaccattaccaatttaccattaattaactgtgttatgctatatttttaggtttgattttgttgctcccagtaccttctttcaa |
100 |
Q |
|
|
||||||| |||| |||||||||||| |||||||| ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
T |
8034866 |
cactcgttgatcacaaccaccattatcaatttacaattaattaactgtgttatgctatgttcttaggtttgattttgttgctcccagtaccttctttcaa |
8034965 |
T |
 |
Q |
101 |
ggttagttactgatctctgttttactacttgtaatgttgatgat |
144 |
Q |
|
|
|||| ||||||||||||||| |||||||||| ||||||| |||| |
|
|
T |
8034966 |
ggttggttactgatctctgtattactacttgaaatgttgttgat |
8035009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 61 - 109
Target Start/End: Complemental strand, 51380148 - 51380100
Alignment:
Q |
61 |
ttttaggtttgattttgttgctcccagtaccttctttcaaggttagtta |
109 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51380148 |
ttttaggtttgattttgttgctcccagtaccttctttcaaggttagtta |
51380100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 188 times since January 2019
Visitors: 3259