View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0448_high_2 (Length: 392)
Name: NF0448_high_2
Description: NF0448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0448_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 30 - 382
Target Start/End: Original strand, 45230089 - 45230441
Alignment:
Q |
30 |
ccacattcaactgcaacatgaaataatcattaagtaacataaacaaatgaggcattaaaaccactttcatgtatatttttgcataccttgccctcatcag |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45230089 |
ccacattcaactgcaacatgaaataatcattaagtaacataaacaaatgaggcattaaaaccactttcatgtatatttttgcataccttgccctcatcag |
45230188 |
T |
 |
Q |
130 |
aatccgagtgacgctgaggaaacactactctcatatcatcatacaagtagaaacttctttcatgttcattgtgcataagatttcttgcttccgaaggtgg |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45230189 |
aatccgagtgacgctgaggaaacactactctcatatcatcatacaagtagaaacttctttcatgttcattgtgcataagatttcttgcttccgaaggtgg |
45230288 |
T |
 |
Q |
230 |
agggtcagaattgcgagtaggaacaaacctcgaatgtttcttaggcaaggggcacataaagcgaaggtgaagagcataaagcatgatacaattgttgaga |
329 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45230289 |
agggtcagaattgcgagtaggaacaaaccttgaatgtttcttaggcaaggggcacataaagcgaaggtgaagagcataaagcatgatacaattgttgaga |
45230388 |
T |
 |
Q |
330 |
gaattgttgttgatctttgaagaaccatttagaaatgtatcacagtcttcatc |
382 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
45230389 |
gaattgttgttgatctttgaagaaccatttagaaatgtgtcacagtcttcatc |
45230441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1882 times since January 2019
Visitors: 3241