View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0448_high_5 (Length: 351)
Name: NF0448_high_5
Description: NF0448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0448_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 29 - 337
Target Start/End: Original strand, 45440636 - 45440948
Alignment:
| Q |
29 |
attttcctaccctccctagctgcaggattgtctgcttcccattctcctaatcatagcaaacacaaataagctaagtagagaacataactaactgcgttat |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
45440636 |
attttcctaccctccctagctgcaggattgtctgcttcccattctcctaatcatagcaaacacaaatcagctaagtagacaacataactaactgcgttat |
45440735 |
T |
|
| Q |
129 |
tataacataaaaaacactcccggcttcaatgatgatacctctaaagtgagctgaaagtttttcacggatctctggattccaagtcctggccttcctttat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45440736 |
tataacataaaaaacactcccggcttcaatgatgatacctctaaagtgagctgaaagtttttcacggatctctggattccaagtcctggccttcctttat |
45440835 |
T |
|
| Q |
229 |
ctctatagtcaagctcaaattgctttgtactcttgatgaaggaagacaataaaaatgaatgaaaatcaatatccatggctagtt----ataaatgacaaa |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
45440836 |
ctctatagtcaagctcaaattgctttgtactcttgatgaaggaagacaataaaaattaatgaaaatcaatatccatggctagctataaataaatgacaaa |
45440935 |
T |
|
| Q |
325 |
gaaacttcccctc |
337 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45440936 |
gaaacttcccctc |
45440948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1606 times since January 2019
Visitors: 3232