View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0448_high_6 (Length: 343)
Name: NF0448_high_6
Description: NF0448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0448_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 302
Target Start/End: Complemental strand, 12328772 - 12328471
Alignment:
| Q |
1 |
taaagggtgaaattatgaaaatcaaagagaatataatcatttgttgaggcatgaccctacacggtttatgtcttgatctttagtcgacacgattttaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12328772 |
taaagggtgaaattatgaaaatcaaagagaatataatcatttgttgaggcatgaccctacacggtttatgtcttgatctttagtcgacacgattttaaaa |
12328673 |
T |
 |
| Q |
101 |
cttgtgattctcactataagaatcttttaagagttagattttcatttgtagaaaatttgactaactaatatctctttcctttcacggtacttatacatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12328672 |
cttgtgattctcactataagaatcttttaagagttagaatttcatttgtagaaaatttgactaactaatatctctttcctttcacggtacttatacatgc |
12328573 |
T |
 |
| Q |
201 |
ttttgcttttaattatcattcttgcgtttaatcaaggtatcaataattcaatgagtggctcaattggttctacttttctacatgtcgagtttgtagaaga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12328572 |
ttttgcttttaattatcattcttgcgtttaatcaaggtatcaataattcaatgagtggctcaattggttctacttttctacatgtcgagtttgtagaaga |
12328473 |
T |
 |
| Q |
301 |
ga |
302 |
Q |
| |
|
|| |
|
|
| T |
12328472 |
ga |
12328471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University