View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0448_low_12 (Length: 317)
Name: NF0448_low_12
Description: NF0448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0448_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 96 - 294
Target Start/End: Complemental strand, 41301904 - 41301705
Alignment:
Q |
96 |
agacaaaaccatatatgaaaataaatacttgtatattacattttcttatgaggctgactccaatttcaatactccgttcacatatattttgtcttctgaa |
195 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41301904 |
agacaaaaccatatatgaaaataaatacttgtatattacattttcttatgaggctgactccaatttcaatactccgttcacatatattttgtcttctgaa |
41301805 |
T |
 |
Q |
196 |
ctacatatacaattgtgtttgaataaat-cnnnnnnnnttatctttaactagataagacgagggaatgcagttaattctcaacattttctatattcttcg |
294 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
41301804 |
ctacatatacaattgtgtttgaataaataaataaataattatctttaactagataagacgagggaatgcagttaattctcaacattttctatattgttcg |
41301705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1829 times since January 2019
Visitors: 3238