View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0448_low_16 (Length: 275)
Name: NF0448_low_16
Description: NF0448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0448_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 18 - 178
Target Start/End: Original strand, 25093089 - 25093249
Alignment:
| Q |
18 |
agatgaaacaggatgtgatgaagcatgggaagaagaaccagttagacagaaacaacgcaacttcgttgctaccaacaaaatcaagaaaggattctaaagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25093089 |
agatgaaacaggatgtgatgaagcatgggaagaagaaccagttagacagaaacaacgcaacttcgttgctaccaacaaaatcaagaaaggattctaaagg |
25093188 |
T |
|
| Q |
118 |
gatgcatggaattactcttttctttcaaagtttcatatcaaagtgttcttttcgatatatt |
178 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25093189 |
gatacatggaattactcttttctttcaaagtttcatatcaaagtgttcttttcgatatatt |
25093249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 27 times since January 2019
Visitors: 3242