View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0448_low_19 (Length: 251)
Name: NF0448_low_19
Description: NF0448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0448_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 12328680 - 12328471
Alignment:
Q |
1 |
ttttaaagcttgtgattctcactataggaatcttttaagagttagattttcatttgtagaaaatttgactaactaatatctctttcctttcacggtactt |
100 |
Q |
|
|
||||||| |||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12328680 |
ttttaaaacttgtgattctcactataagaatcttttaagagttagaatttcatttgtagaaaatttgactaactaatatctctttcctttcacggtactt |
12328581 |
T |
 |
Q |
101 |
atacatgcttttgcttttaattatcattcttgcgtttaatcaaggtatcaataattcaatgagtggctcaattggttctacttttctacatgtcgagttt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12328580 |
atacatgcttttgcttttaattatcattcttgcgtttaatcaaggtatcaataattcaatgagtggctcaattggttctacttttctacatgtcgagttt |
12328481 |
T |
 |
Q |
201 |
gtagaagaga |
210 |
Q |
|
|
|||||||||| |
|
|
T |
12328480 |
gtagaagaga |
12328471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1816 times since January 2019
Visitors: 3237