View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0448_low_20 (Length: 250)
Name: NF0448_low_20
Description: NF0448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0448_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 53944928 - 53944721
Alignment:
Q |
1 |
ccaagacttcgtaattatcactggacatgcaatattttgatttataggacccaaatttggtgagcaggtaaagaaattctaaattagaaagtattttcct |
100 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53944928 |
ccaagacttcctaattatcactggacatgcaatattttgattaataggacccaaatttggtgagcaggtaaagaaattctaaattagaaagtattttcct |
53944829 |
T |
 |
Q |
101 |
aatgaaaacaatgaatgnnnnnnncccaccagacgaagttggttacattgattgaacaacgacaccattactactgtcatcaataataagactcattttg |
200 |
Q |
|
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53944828 |
aatgaaaacaatgaatgtttttttcccactagacgaagttggttacattgattgaacaacgacaccattactactgtcatcaataataagactcattttg |
53944729 |
T |
 |
Q |
201 |
cagggatg |
208 |
Q |
|
|
|||||||| |
|
|
T |
53944728 |
cagggatg |
53944721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 59 times since January 2019
Visitors: 3244