View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0449_high_9 (Length: 251)

Name: NF0449_high_9
Description: NF0449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0449_high_9
NF0449_high_9
[»] chr1 (1 HSPs)
chr1 (30-153)||(42017639-42017768)


Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 30 - 153
Target Start/End: Original strand, 42017639 - 42017768
Alignment:
30 gcatcatggatcgcaattgcagccacatcatacctaattgactgcaatttgctcggtata------accctaatgtgatcgtcgtataaaaccttgatca 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      ||||||||||||||||||||||||||||||||||    
42017639 gcatcatggatcgcaattgcagccacatcatacctaattgactgcaatttgctcggtataattataaccctaatgtgatcgtcgtataaaaccttgatca 42017738  T
124 acatcaaccaaaagccgtgtctattgaatg 153  Q
    ||||||||| ||||||||||||||||||||    
42017739 acatcaaccgaaagccgtgtctattgaatg 42017768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University