View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0449_low_10 (Length: 322)
Name: NF0449_low_10
Description: NF0449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0449_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 4 - 230
Target Start/End: Complemental strand, 22278346 - 22278120
Alignment:
| Q |
4 |
ggtttattcagattatgtttgtttgagtaaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttgg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22278346 |
ggtttattcagattatgtttgtttgagtaaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttgg |
22278247 |
T |
 |
| Q |
104 |
tggatcagggtgattgttgtattgtacgtctgtggcgaggtacgaagtataaagtgggtgggtgaaggaggggagtctgggagggtcgagttggtggaaa |
203 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22278246 |
tggatcagggggattgttgtattgtacgtctgtggcgaggtacgaagtataaagtgggtgggtgaaggaggggggtctgggagggtcgagttggtggaag |
22278147 |
T |
 |
| Q |
204 |
gatatcgtgaggattcgtgatgatgtc |
230 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
22278146 |
gatatcgtgaggattcgtgatgatgtc |
22278120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 32 - 108
Target Start/End: Complemental strand, 7287375 - 7287299
Alignment:
| Q |
32 |
aaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtggat |
108 |
Q |
| |
|
||||||||||||||| |||||||| || ||||| |||| |||||| || || | || |||||||| |||||| |||| |
|
|
| T |
7287375 |
aaggaggaaggaggtttgggggtgcggcggttatgtgaatttaatatttcattattaggaaaatggtgttggcggat |
7287299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 32 - 108
Target Start/End: Complemental strand, 7288043 - 7287967
Alignment:
| Q |
32 |
aaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtggat |
108 |
Q |
| |
|
||||||||||||||| |||||||| || ||||| |||| |||||| || || | || |||||||| |||||| |||| |
|
|
| T |
7288043 |
aaggaggaaggaggtttgggggtgcggcggttatgtgaatttaatatttcattattaggaaaatggtgttggcggat |
7287967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 105
Target Start/End: Original strand, 51072127 - 51072196
Alignment:
| Q |
36 |
aggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtg |
105 |
Q |
| |
|
||||||||||| ||||||| ||| || | || |||||||||||||| ||||| || ||||| |||||||| |
|
|
| T |
51072127 |
aggaaggaggtttgggggtcaggaggatgagggagtttaatgttgctctgttagggaaatggtgttggtg |
51072196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University