View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0449_low_3 (Length: 425)
Name: NF0449_low_3
Description: NF0449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0449_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 338 - 391
Target Start/End: Complemental strand, 42010418 - 42010365
Alignment:
| Q |
338 |
gcttttgaatcttgtaaagctgaggagataaacgtgatgaagacgatgatgatg |
391 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42010418 |
gcttttgaatcttgtaaagccgaggagataaacgtgatgaagacgatgatgatg |
42010365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 338 - 384
Target Start/End: Complemental strand, 1245756 - 1245710
Alignment:
| Q |
338 |
gcttttgaatcttgtaaagctgaggagataaacgtgatgaagacgat |
384 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1245756 |
gcttttgaatcttgtaaagccgaggagataaacgtgatgaagacgat |
1245710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1546 times since January 2019
Visitors: 3232