View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0450_high_4 (Length: 307)
Name: NF0450_high_4
Description: NF0450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0450_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 8e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 28 - 222
Target Start/End: Original strand, 2115628 - 2115822
Alignment:
| Q |
28 |
tactagtagtaggatttggaattgtagctcctggagatatatatggagattgcaatgctgaaacaaatgctgatgaaggtggagaaacaagaggtgattc |
127 |
Q |
| |
|
||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2115628 |
tactagtagtagggtttggaattgtggctcttggagatatatatggagattgcaatgctgaaacaaatgctgatgaaggtggagaaacaagaggtgattc |
2115727 |
T |
|
| Q |
128 |
ataaggtgatgattctatggaagtttttgtgtttggtgaaggtaaatttgaagcattgtcttcaccttgttttttgatactacttgttgcaatct |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
2115728 |
ataaggtgatgattctatggaagtttttgtgtttggtgaaggtaaatttgaagtattgtcttcaccttgtttcttgatactacttggtgcaatct |
2115822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1905 times since January 2019
Visitors: 3241