View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0450_low_1 (Length: 492)
Name: NF0450_low_1
Description: NF0450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0450_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 101 - 480
Target Start/End: Original strand, 10863880 - 10864259
Alignment:
Q |
101 |
cgtcccaccttacgaggtttactattaccaaaatcactaaaatttggatgtttgtggtggctagtctgccaaacattgcagttttatctatatgattgac |
200 |
Q |
|
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10863880 |
cgtcccaccttaggaggtttactattaccaaaatcactaaaatttggatgtttgtggtggctagtctgccaaacattgcagttttatctatatgattgac |
10863979 |
T |
 |
Q |
201 |
tttttgtatgcactcgtttgatctaaactttggcctccaaaccttattaatcaccttattctatttcccacacgttctgaacaaagtaggctaagagaat |
300 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10863980 |
tttttgtatgaactcgtttgatctaaactttggccttcaaaccttattaatcaccttattctatttcccacacgttctgaacaaagtaggctaagagaat |
10864079 |
T |
 |
Q |
301 |
gataccattaccatcttcataacttggaaaggatcgatattaatggctatctcttccatccttttgttggatagttcaaacttgtcttccttaataggat |
400 |
Q |
|
|
|||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| ||| |
|
|
T |
10864080 |
gataccattaccatcttcataacttggaaaggattgttattaatggctatctcttccatccttttgtgggatagttcaaacttttcttccttaataagat |
10864179 |
T |
 |
Q |
401 |
tttgaatggccttatgagacaaaatgtaattgttcgttgagcgattttaaaagttgtgctatttgcaaaacattttgcct |
480 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |||||||||||| |
|
|
T |
10864180 |
tttgaatggccttatgagacaaaatgtaattgttcgttgagtgattttaagagttgtgctatttgcagaacattttgcct |
10864259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University