View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0450_low_10 (Length: 268)
Name: NF0450_low_10
Description: NF0450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0450_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 52 - 249
Target Start/End: Complemental strand, 39331706 - 39331509
Alignment:
| Q |
52 |
cattaataacatgttggatatcggggtgggacagaaatggtaaacatgtacttttaatgctgtaaaattaacagaccaacttaaagctcnnnnnnnnnnn |
151 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39331706 |
cattaataacatgttggatatcgggatgtgacagaaatggtaaacatgtacttttaatgctgtaaaattaatagaccaacttaaagctcaaaattaaatt |
39331607 |
T |
 |
| Q |
152 |
nnnnnnnnnnnnggttagctaatagattgtgttgaattgattcaacaattgactaggtattggtgaaatgacatactgtaaacctcaacaattctcta |
249 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39331606 |
aaaaaacaaaaaggttagctaattgattgtgttgaattgattcaacaattgactaggtattggtgaaatgacatactgtaaacctcaacatttctcta |
39331509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University